back to the index

BCdatabaser output files

• Directory name format
• Sequence data
• Syntax of taxonomy
• Visualisation as Krona Charts
• Additional files

Directory name format

In the webinterface, the name format of the zip file/directory is determined by input paramters, with the scheme:

<MARKER>.<TAXONOMIC-RANGE>.<TAXA-RESTRICTION-LIST>.<DATE>

e.g.:

coi.insecta.DE-Frankonia.2019-10-24

In this extracted directory the following files are present. We recommend to also follow this file format in the command line version, especially if deposited in a database as a reference set (see also: Public deposition).

Sequence data

• sequences.tax.fa All result sequences including taxonomy information parsed into the header (sse Syntax below)

  >LS453445;tax=k:Metazoa,p:Arthropoda,c:Insecta,o:Coleoptera,f:Carabidae,g:Molops,s:Molops_piceus;
  ACATCCTGAAGTTTATATTTTAATTCTCCCAGGATTTGGAATAATTTCCCATATTATTAGACAAGAAAGA
  GGTAAAAAAGAAACATTTGGTTCATTAGGAATAATTTATGCTATATTAGCTATTGGTTTATTAGGATTTG
  [...]
  

• sequences.fa All result sequences without taxonomy, basically the sequences as have been named in NCBI

  >LS453445.1 Molops piceus mitochondrial partial COI gene for cytochrome oxidase subunit 1, specimen voucher MNCN-AI362
  ACATCCTGAAGTTTATATTTTAATTCTCCCAGGATTTGGAATAATTTCCCATATTATTAGACAAGAAAGA
  GGTAAAAAAGAAACATTTGGTTCATTAGGAATAATTTATGCTATATTAGCTATTGGTTTATTAGGATTTG
  [...]
  

Syntax of taxonomy

Taxonomy is included in a syntax directly in the FASTA header as used by a variety of classifiers. Slight modifications might be necessary for some software tools accpt this format (see also the classification documentation). In more detail, we follow strictly the SINTAX nomenclature as described in the USEARCH manual:

><UNIQUEID>;tax=k:Kingdom,p:Phylum,c:Class,o:Order,f:Family,g:Genus,s:Species;

e.g.:

>LS453445;tax=k:Metazoa,p:Arthropoda,c:Insecta,o:Coleoptera,f:Carabidae,g:Molops,s:Molops_piceus;

The syntax is very similar to the RDP variant of the nomenclature:

>LS453445	Metazoa;Arthropoda;Insecta;Coleoptera;Carabidae;Molops;Molops_piceus

and can be parsed with this command:

sed -e "s/;tax=k:/\t/" -e "s/,[^:]:/;/g" sequences.tax.fa  > sequences.tax.rdp.fa 

Also it is very similar to the Greengenes variant of the nomenclature:

>LS453445  k__Metazoa;p__Arthropoda;c__Insecta;o__Coleoptera;f__Carabidae;g__Molops;s__:Molops_piceus

and can be parsed with this command:

sed -e "s/;tax=k:/\t/" -e "s/,/;/g" -e "s/:/__/g" sequences.tax.fa  > sequences.tax.gg.fa 

Visualisation as Krona Charts

In the directory, there is also a visual and interactive summary of sequences included in the final dataset, named as taxonomy.krona.html. This file can be viewed and interacted with using a standard internet browser. For large databases, the data of the chart may also be located in a corresponding subdirectory.

Additional files

Also in the directory will be more files which may be interesting:

• CITATION, the same file as in this repository including CITATION information for BCdatabaser and internally used tools
• bcdatabaser.log A file that logs all of the steps BCdatabaser has performed, paramaters and if unsuccessfull error descriptions, e.g.:

  [...]
  [10-24 08:44:38] [BCdatabaser] Finished: Add CITATION file to output directory
  [10-24 08:44:38] [BCdatabaser] Starting: Zipping output directory
  [10-24 08:44:38] [BCdatabaser] zip -r coi.insecta.DE-Frankonia.2019-10-24.zip coi.insecta.DE-Frankonia.2019-10-24
  

• four list files:
  • list.txt, all sequence hits given the taxonomic range, taxa list and/or length restriction
  • list.sorted.txt the same list, yet sorted according to sequence length
  • list.filtered.txt the sorted list limited to --sequences-per-taxon per taxon
  • taxa_list.txt the taxa name list included in the analyses, if used