A pipeline to create reference databases for arbitrary markers and taxonomic groups from NCBI data
This project is maintained by molbiodiv
In the webinterface, the name format of the zip file/directory is determined by input paramters, with the scheme:
<MARKER>.<TAXONOMIC-RANGE>.<TAXA-RESTRICTION-LIST>.<DATE>
e.g.:
coi.insecta.DE-Frankonia.2019-10-24
In this extracted directory the following files are present. We recommend to also follow this file format in the command line version, especially if deposited in a database as a reference set (see also: Public deposition).
sequences.tax.fa All result sequences including taxonomy information parsed into the header (sse Syntax below)
>LS453445;tax=k:Metazoa,p:Arthropoda,c:Insecta,o:Coleoptera,f:Carabidae,g:Molops,s:Molops_piceus;
ACATCCTGAAGTTTATATTTTAATTCTCCCAGGATTTGGAATAATTTCCCATATTATTAGACAAGAAAGA
GGTAAAAAAGAAACATTTGGTTCATTAGGAATAATTTATGCTATATTAGCTATTGGTTTATTAGGATTTG
[...]
sequences.fa All result sequences without taxonomy, basically the sequences as have been named in NCBI
>LS453445.1 Molops piceus mitochondrial partial COI gene for cytochrome oxidase subunit 1, specimen voucher MNCN-AI362
ACATCCTGAAGTTTATATTTTAATTCTCCCAGGATTTGGAATAATTTCCCATATTATTAGACAAGAAAGA
GGTAAAAAAGAAACATTTGGTTCATTAGGAATAATTTATGCTATATTAGCTATTGGTTTATTAGGATTTG
[...]
Taxonomy is included in a syntax directly in the FASTA header as used by a variety of classifiers. Slight modifications might be necessary for some software tools accpt this format (see also the classification documentation). In more detail, we follow strictly the SINTAX nomenclature as described in the USEARCH manual:
><UNIQUEID>;tax=k:Kingdom,p:Phylum,c:Class,o:Order,f:Family,g:Genus,s:Species;
e.g.:
>LS453445;tax=k:Metazoa,p:Arthropoda,c:Insecta,o:Coleoptera,f:Carabidae,g:Molops,s:Molops_piceus;
The syntax is very similar to the RDP variant of the nomenclature:
>LS453445 Metazoa;Arthropoda;Insecta;Coleoptera;Carabidae;Molops;Molops_piceus
and can be parsed with this command:
sed -e "s/;tax=k:/\t/" -e "s/,[^:]:/;/g" sequences.tax.fa > sequences.tax.rdp.fa
Also it is very similar to the Greengenes variant of the nomenclature:
>LS453445 k__Metazoa;p__Arthropoda;c__Insecta;o__Coleoptera;f__Carabidae;g__Molops;s__:Molops_piceus
and can be parsed with this command:
sed -e "s/;tax=k:/\t/" -e "s/,/;/g" -e "s/:/__/g" sequences.tax.fa > sequences.tax.gg.fa
In the directory, there is also a visual and interactive summary of sequences included in the final dataset, named as taxonomy.krona.html. This file can be viewed and interacted with using a standard internet browser. For large databases, the data of the chart may also be located in a corresponding subdirectory.

Also in the directory will be more files which may be interesting:
CITATION, the same file as in this repository including CITATION information for BCdatabaser and internally used toolsbcdatabaser.log A file that logs all of the steps BCdatabaser has performed, paramaters and if unsuccessfull error descriptions, e.g.:
[...]
[10-24 08:44:38] [BCdatabaser] Finished: Add CITATION file to output directory
[10-24 08:44:38] [BCdatabaser] Starting: Zipping output directory
[10-24 08:44:38] [BCdatabaser] zip -r coi.insecta.DE-Frankonia.2019-10-24.zip coi.insecta.DE-Frankonia.2019-10-24
list.txt, all sequence hits given the taxonomic range, taxa list and/or length restrictionlist.sorted.txt the same list, yet sorted according to sequence lengthlist.filtered.txt the sorted list limited to --sequences-per-taxon per taxontaxa_list.txt the taxa name list included in the analyses, if used